mRNA Cap N6 Methyltransferase (m6A) is a cap-specific adenosine methyltransferase that methylates the N6 position of an initiating adenine of 5´ capped RNA transcripts.
Enables enzymatic modification of capped mRNAs
Simplify workflows with a low-cost, one-pot reaction to generate Cap-1 m6A RNAs with FCE and mRNA Cap 2´-O-Methyltransferase
Improve translation and transcript stability using Cap-1 m6A - a naturally occurring modification and an alternative to synthetic 3′-O-methyl cap analogs.
mRNA Cap N6 Methyltransferase (m6A) adds a methyl group at the N6 position of the initiating adenine of 5´ capped RNA transcripts. This enzyme utilizes S-adenosylmethionine (SAM) as a methyl donor to methylate the initiating adenine of capped RNAs, resulting in N6-methyladenosine (m6A). It is critical that the RNA is capped (i.e., Cap-0 or Cap-1 RNA), and the first nucleotide adjacent to the cap at the 5´ end of the RNA is adenine in order to be methylated. When this N6 methylation occurs on a Cap-1 transcript, which already contains a 2´-O-methyl group, the resulting modification is N6,2′-O-dimethyladenosine (m6Am or Cap-1 m6A), a naturally occurring, cap-proximal modification commonly found in eukaryotic mRNAs and enriched in certain vertebrate tissues. Growing evidence suggests that N6,2′-O-dimethyladenosine influences translation efficiency, such as by reducing mRNA decapping and increasing mRNA stability.
If using T7 RNA polymerase to synthesize uncapped RNA that initiates with adenine, we recommend the T7 Promoter class II with the first three transcribed nucleotides being AGA: 5'- TAATACGACTCACTATTAGA 3'. T7 RNA polymerase starts transcription at the underlined A (+1 position) in the sequence.
Figure 1: Schematic representation of Cap-1 m6A RNA showing the 7-methylguanosine cap (m7G), the 5´ to 5´ triphosphate linkage (ppp), and the initiating N6, 2´-O-dimethyladenosine (m6Am)
Figure 2: 50U of mRNA Cap N6 Methyltransferase (m6A) can fully methylate up to 180 µg of capped RNA after 1 h at 37°C in 1X Capping Buffer, if the RNA transcript initiates with adenine (+1 A). This methyltransferase will not methylate uncapped RNAs. More enzyme and/or longer reaction times may be needed for RNAs that are shorter than 1000 nt
This product is related to the following categories:
Mauer J, et al. (2017). Reversible methylation of m6Am in the 5' cap controls mRNA stability. Nature. Jan 19;541(7637), 371-375. PubMedID: 28002401
Akichika S, et al. (2019). Cap-specific terminal N6-methylation of RNA by an RNA polymerase II-associated methyltransferase. Science. Jan 11;363(6423), eaav0080. PubMedID: 30467178
Sendinc E, et al. (2019). PCIF1 Catalyzes m6Am mRNA Methylation to Regulate Gene Expression. Mol Cell. Aug 8;75(3), 620-630.e9. PubMedID: 31279659
Boulias K, et al. (2019). Identification of the m6Am Methyltransferase PCIF1 Reveals the Location and Functions of m6Am in the Transcriptome. Mol Cell. Aug 8;75(3), 631-643. PubMedID: 31279658
Sikorski PJ, et al. (2020). The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5′ cap modulates protein expression in living cells. Nucleic Acids Res. Feb 28;48(4), 1607-1626. PubMedID: 31984425
Mandell ZF, et al. (2025). CleanCap M6 inhibits decapping of exogenously delivered IVT mRNA. Mol Ther Nucleic Acids. Jan 17;36(1), 102456. PubMedID: 39974289
Liu JF, et al. (2025). Decoding m6Am by simultaneous transcription-start mapping and methylation quantification. Elife. Mar 31:13, RP104139. PubMedID: 40162895
Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.
Specifications & Change Notifications
The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]
The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]
Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.
This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.
New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.
Based on your Freezer Program type, you are trying to add a product to your cart that is either not allowed or not allowed with the existing contents of your cart. Please review and update your order accordingly. If you have any questions, please contact Customer Support at freezers@neb.com or 1-800-632-5227 x 8.
Choose your country
North America
Europe
Asia-Pacific
Session Expired
Your session has expired
You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.
Please sign in to continue shopping.
Institution Changed
Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.
Sign in to your NEB account
To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.
Need a custom/large volume order? Contact us
Powered by Bioz
