HomeFAQsWhat are the design rules for the target-specific oligos?
FAQ: What are the design rules for the target-specific oligos?
A 20 nucleotide target-specific sequence is selected. We recommend using a target DNA selection program. Make sure to remove the PAM (NGG) sequence. First, the T7 promoter sequence (5´ TTCTAATACGACTCACTATA 3´) is appended to the 5´ end of the target-specific sequence. If the first nucleotide of the target specific region is a G, no nucleotides need to be added. If there is no G present, add one G to the 3´ end of the T7 promoter sequence (..TATAG..), just upstream of the target-specific sequence. Next, append the 14-nucleotide overlap (5´ GTTTTAGAGCTAGA 3´) to the 3´ end of the target-specific sequence. The complete sequence represents the target-specific oligo to be ordered. This oligo will hybridize with the complementary sequence on the scaffold oligo provided in the 2X sgRNA Reaction Mix and create the template for dsDNA synthesis by the DNA polymerase contained within the sgRNA Enzyme Mix.
Choose your country
North America
Europe
Asia-Pacific
Session Expired
You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.
Institution Changed
Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.
Sign in to your NEB account
To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.